blunt ta ligase master mix (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
blunt ta ligase master mix
Blunt Ta Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blunt+ta+ligase+master+mix/Blunt%2FTA+Ligase+Master+Mix/pmc13049905-118-20-24
Average 99 stars, based on 1134 article reviews
Blunt Ta Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1134 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blunt+ta+ligase+master+mix/Blunt%2FTA+Ligase+Master+Mix/pmc13049905-118-20-24
Average 99 stars, based on 1134 article reviews
blunt ta ligase master mix - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Ligation:Article Title: Genetic modification of intractable bacterial clones by heat shock-facilitated phage transduction. Article Snippet: Twelve microliters of template DNA were supplemented with the necessary reagents from the NEBNext Ultra II end repair/dA tailing kit (E7546S; New England Biolabs [NEB]) and the reaction was incubated at 20◦C for 5 min and then at 65◦C for 5 min. .. Subsequently, 3 mL of nuclease-free water, 0.75 mL end-prepped DNA, 1 mL native barcode (native barcoding expansion 96; EXP-NBD196), and 5 mL Article Title: Improved deconvolution of circulating tumor DNA from ultra-low-pass whole-genome methylation sequencing using CelFiE-ISH Article Snippet: DNA was cleaned with 2.3x magnetic beads (Agencourt AMPure XP, BC-A63881), washed 2x with 80% ethanol and eluted with 11ul Nuclease-free Water (NEB #B1500). .. Barcode ligation used Article Title: Occurrence and subtyping of the intestinal protozoan Blastocystis sp. in French oyster areas reveal potential fecal contamination routes and associated risks to consumer health Article Snippet: Briefly, sequencing libraries were prepared with the Native Barcoding Kit (Oxford Nanopore Technologies) following the manufacturer's instructions. .. Amplicons were end-repaired and dA-tailed using the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Ipswich, MA, USA), barcoded with the Article Title: Psychrobacillus syltrankelensis sp. nov., a new species isolated from soil in the North Caucasus, Russia. Article Snippet: Genomic DNA for Oxford Nanopore sequencing was isolated using the MagBeads FastDNA Kit for Microbiome (MP Biomedicals, Santa Ana, CA, USA) according to the manufacturer’s instructions. .. Libraries were prepared following the manufacturer’s protocol with the Native Barcoding Kit 24 V14 (Oxford Nanopore Technologies Ltd, Oxford, UK), the NEBNext Companion Module for Oxford Nanopore Technologies Ligation Sequencing (New England Biolabs, Ipswich, MA, USA), NEBNext Quick Ligation Reaction Buffer, and Article Title: Within-host diversity and phased variant analysis reveal structures and recombination of Helicobacter pylori subpopulations in stomach. Article Snippet: For NGS, libraries were prepared using the NEBNext DNA Library Prep Kit and sequenced on MGISEQ-2000 and Illumina NovaSeq 6000 platforms to generate 150-bp paired-end reads. .. For Oxford Nanopore sequencing, DNA ends were repaired using the NEBNext Ultra II End Repair Kit; nloaded from https://academ ic.oup.com /gigascience/advance-article/doi/10.1093/gigascience/giag046/8655893 by U niversidade Federal da Paraiba (U FPB) user on 18 April 2026 O R IG IN A L U N E D IT E D M A N U S C R IP T barcodes were ligated using the NEB Incubation:Article Title: Genetic modification of intractable bacterial clones by heat shock-facilitated phage transduction. Article Snippet: Twelve microliters of template DNA were supplemented with the necessary reagents from the NEBNext Ultra II end repair/dA tailing kit (E7546S; New England Biolabs [NEB]) and the reaction was incubated at 20◦C for 5 min and then at 65◦C for 5 min. .. Subsequently, 3 mL of nuclease-free water, 0.75 mL end-prepped DNA, 1 mL native barcode (native barcoding expansion 96; EXP-NBD196), and 5 mL Sequencing:Article Title: Occurrence and subtyping of the intestinal protozoan Blastocystis sp. in French oyster areas reveal potential fecal contamination routes and associated risks to consumer health Article Snippet: Briefly, sequencing libraries were prepared with the Native Barcoding Kit (Oxford Nanopore Technologies) following the manufacturer's instructions. .. Amplicons were end-repaired and dA-tailed using the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Ipswich, MA, USA), barcoded with the Article Title: Psychrobacillus syltrankelensis sp. nov., a new species isolated from soil in the North Caucasus, Russia. Article Snippet: Genomic DNA for Oxford Nanopore sequencing was isolated using the MagBeads FastDNA Kit for Microbiome (MP Biomedicals, Santa Ana, CA, USA) according to the manufacturer’s instructions. .. Libraries were prepared following the manufacturer’s protocol with the Native Barcoding Kit 24 V14 (Oxford Nanopore Technologies Ltd, Oxford, UK), the NEBNext Companion Module for Oxford Nanopore Technologies Ligation Sequencing (New England Biolabs, Ipswich, MA, USA), NEBNext Quick Ligation Reaction Buffer, and Article Title: Within-host diversity and phased variant analysis reveal structures and recombination of Helicobacter pylori subpopulations in stomach. Article Snippet: For NGS, libraries were prepared using the NEBNext DNA Library Prep Kit and sequenced on MGISEQ-2000 and Illumina NovaSeq 6000 platforms to generate 150-bp paired-end reads. .. For Oxford Nanopore sequencing, DNA ends were repaired using the NEBNext Ultra II End Repair Kit; nloaded from https://academ ic.oup.com /gigascience/advance-article/doi/10.1093/gigascience/giag046/8655893 by U niversidade Federal da Paraiba (U FPB) user on 18 April 2026 O R IG IN A L U N E D IT E D M A N U S C R IP T barcodes were ligated using the NEB Purification:Article Title: Host exonuclease SbcB and a phage-encoded SSB-like protein control activation of the DRT10 reverse transcriptase defense system Article Snippet: An anchored primer (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTTTTTTTTV-3’) was annealed to the poly-A tails and extended with exo- Klenow polymerase (New England Biolabs). .. Reaction products were purified using QIAquick PCR cleanup columns (Qiagen) and ligated to pre-annealed adapters (top strand: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT-3’; bottom strand: 5’- /5Phos/CTGTCTCTTATACACATCTGACGCTGCCGACGA/3AmMO/-3’) using Polymerase Chain Reaction:Article Title: Host exonuclease SbcB and a phage-encoded SSB-like protein control activation of the DRT10 reverse transcriptase defense system Article Snippet: An anchored primer (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTTTTTTTTV-3’) was annealed to the poly-A tails and extended with exo- Klenow polymerase (New England Biolabs). .. Reaction products were purified using QIAquick PCR cleanup columns (Qiagen) and ligated to pre-annealed adapters (top strand: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT-3’; bottom strand: 5’- /5Phos/CTGTCTCTTATACACATCTGACGCTGCCGACGA/3AmMO/-3’) using |