blunt ta ligase master mix (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
blunt ta ligase master mix
Blunt Ta Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1158 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blunt+ta+ligase+master+mix/Blunt%2FTA+Ligase+Master+Mix/10__1038_slash_s41598___026___74202___2-97-28-27
Average 99 stars, based on 1158 article reviews
Blunt Ta Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1158 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/blunt+ta+ligase+master+mix/Blunt%2FTA+Ligase+Master+Mix/10__1038_slash_s41598___026___74202___2-97-28-27
Average 99 stars, based on 1158 article reviews
blunt ta ligase master mix - by Bioz Stars,
2026-10
99/100 stars
Images
Related Articles
Sequencing:Article Title: Occurrence and subtyping of the intestinal protozoan Blastocystis sp. in French oyster areas reveal potential fecal contamination routes and associated risks to consumer health Article Snippet: Briefly, sequencing libraries were prepared with the Native Barcoding Kit (Oxford Nanopore Technologies) following the manufacturer's instructions. .. Amplicons were end-repaired and dA-tailed using the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Ipswich, MA, USA), barcoded with the Ligation:Article Title: Occurrence and subtyping of the intestinal protozoan Blastocystis sp. in French oyster areas reveal potential fecal contamination routes and associated risks to consumer health Article Snippet: Briefly, sequencing libraries were prepared with the Native Barcoding Kit (Oxford Nanopore Technologies) following the manufacturer's instructions. .. Amplicons were end-repaired and dA-tailed using the NEBNext Ultra II End Repair/dA-Tailing Module (NEB, Ipswich, MA, USA), barcoded with the Multiplexing:Article Title: NanoTS: a deep learning tool for accurate SNP calling in nanopore long-read transcriptome data. Article Snippet: Briefly, 120 ng of cDNA was repaired and dA-tailed using the NEBNext Ultra II End Repair/dA-tailing Module (NEB, cat. no. E7546L) followed by purification with DNA Clean Beads. .. For multiplexing, the repaired DNA was barcoded using the Native Barcode kit with NEB Purification:Article Title: NanoTS: a deep learning tool for accurate SNP calling in nanopore long-read transcriptome data. Article Snippet: Briefly, 120 ng of cDNA was repaired and dA-tailed using the NEBNext Ultra II End Repair/dA-tailing Module (NEB, cat. no. E7546L) followed by purification with DNA Clean Beads. .. For multiplexing, the repaired DNA was barcoded using the Native Barcode kit with NEB Article Title: Host exonuclease SbcB and a phage-encoded SSB-like protein control activation of the DRT10 reverse transcriptase defense system Article Snippet: An anchored primer (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTTTTTTTTV-3’) was annealed to the poly-A tails and extended with exo- Klenow polymerase (New England Biolabs). .. Reaction products were purified using QIAquick PCR cleanup columns (Qiagen) and ligated to pre-annealed adapters (top strand: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT-3’; bottom strand: 5’- /5Phos/CTGTCTCTTATACACATCTGACGCTGCCGACGA/3AmMO/-3’) using Polymerase Chain Reaction:Article Title: Host exonuclease SbcB and a phage-encoded SSB-like protein control activation of the DRT10 reverse transcriptase defense system Article Snippet: An anchored primer (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTTTTTTTTTV-3’) was annealed to the poly-A tails and extended with exo- Klenow polymerase (New England Biolabs). .. Reaction products were purified using QIAquick PCR cleanup columns (Qiagen) and ligated to pre-annealed adapters (top strand: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGT-3’; bottom strand: 5’- /5Phos/CTGTCTCTTATACACATCTGACGCTGCCGACGA/3AmMO/-3’) using |